flowres flowres

11-11-2016
Mathematics

contestada

27 milliliters .1/10 cm is the one and ten is the mm one =

Respuesta :

ampofoeugenia7 ampofoeugenia7

20-11-2016

10 mm= 1cm
27 mm=?
27/10*1cm=2.7cm

Answer Link

Otras preguntas

When a phosphate bond is hydrolyzed, energy is released. the remaining adp is at a higher or lower energy state?

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

The price of a television was reduced from two hundred and fifty to two hundred bye wo percentage was the price of the TV reduce

Vowels in Spanish are very important. Every vowel is pronounced all the time and vowels are pronounced ________.

Which gastrointestinal secretion has a component that is required for the intestinal absorption of vitamin b12?

As a factor of production, how is capital created? A. By adding land to entrepreneurship B. By adding human labor to land C. By removing land from services D. B

—¿Cuántas horas duermes? —_____ siete horas.

What is the connotative effect of the word pale, which is repeated so frequently throughout this poem?

Help me plzz!! 20 points

_ occurs when two drugs being taken cancel out each other effects 1. Drug antagonism 2. Drug synergism 3. A drug overdose 4. Withdrawal